Listerien

Listeria monocytogenes

Zuletzt geändert: 14.12.2020
Icon

Tierseuchenkategorien:

Steckbrief

Listerien sind Bakterien. Sie sind die Erreger der Listeriose, einer seltenen, hauptsächlich durch Lebensmittel übertragenen Erkrankung.

Vorkommen

Listerien sind in der Umwelt weit verbreitet, z. B. in Abwässern, in der Erde und auf Pflanzen. Lebensmittel tierischer Herkunft wie Rohmilch und Rohmilchprodukte sowie rohes Fleisch, aber auch Fleisch- und Fischprodukte wie aufgeschnittene, abgepackte Wurst und Räucherfisch können Listerien enthalten. Aus pasteurisierter Milch hergestellte Produkte wie Schmier- oder Weichkäse können während der Herstellung kontaminiert werden.

Erregerreservoir

L. monocytogenes kann häufig in der Umwelt, im Boden und Wasser gefunden werden. Tiere können den Erreger zwar ohne zu erkranken in sich tragen, es kommen bei Wiederkäuern aber durch Listerien verursachte Fehlgeburten vor. Lebensmittelverarbeitende Betriebe können ein Reservoir für diese Erreger darstellen, in deren Folge (weiter-)verarbeitete Nahrungsmittel kontaminiert werden. Auf Grund ihrer Fähigkeit zu Wachstum auch bei niedrigen Temperaturen vermehren sich Listerien sogar im Kühlschrank; daher können kontaminierte Lebensmittel nach Lagerung im Kühlschrank hohe Keimzahlen enthalten.

Infektionsweg

Die Erregeraufnahme erfolgt hauptsächlich durch den Verzehr von kontaminierten tierischen und pflanzlichen Lebensmitteln. Bei Schwangeren können die Erreger auch ohne jegliche Symptome einer mütterlichen Erkrankung auf das ungeborene Kind übertragen werden. Sehr selten findet auch eine Weiterverbreitung durch Übertragung von Mensch zu Mensch (Krankenhausinfektionen von Neugeborenen) sowie durch direkten Kontakt mit infizierten Tieren (Hautinfektionen) statt.

Inkubationszeit

Im Rahmen einer Lebensmittelinfektion können sich erste Krankheitszeichen innerhalb von 1-70 Tagen zeigen. Septikämische Verläufe: 1-12 Tage (Median 2 Tage); neurologische Verläufe: 1-14 Tage (Median 9 Tage); schwangerschaftsassoziierte Fälle: 17-70 Tage (Median 27,5 Tage).

Symptomatik

Bei gesunden Erwachsenen verläuft eine Infektion meist ohne Krankheitszeichen oder nur mit Durchfall. Im Allgemeinen schützt das menschliche Immunsystem ausreichend gegen schwere Krankheitsverläufe und viele Infektionen vergehen praktisch unbemerkt und ohne Folgen. Schwere Erkrankungen betreffen hauptsächlich immungeschwächte Menschen (z. B. an Krebs Erkrankte, PatientInnen unter hochdosierter Cortisontherapie etc.). Wird eine Listeriose diagnostiziert, liegt fast immer ein invasiver Krankheitsverlauf vor, das bedeutet, dass die Bakterien jenseits des Verdauungstraktes streuen. Die invasive Listeriose äußert sich durch heftige Kopfschmerzen, starkes Fieber, Übelkeit und Erbrechen. In der Folge kann es zu Hirn- bzw. Hirnhautentzündung oder Sepsis (Blutvergiftung) kommen, die bei rund einem Viertel der Patientinnen und Patienten tödlich enden. Die Erreger können aber auch an anderen Körperstellen entzündliche Prozesse verursachen (z. B. Wirbelkörperentzündungen), diese Folgen werden aber selten beobachtet. Bei Schwangeren besteht die Gefahr einer Infektion des ungeborenen Kindes mit dem Risiko, dass es zu einer Früh- oder Totgeburt kommt. Beim infizierten Neugeborenen können sich Sepsis und Meningitis entwickeln.


Wenn VerbraucherInnen Sorge haben, sich nach Warnungen möglicherweise über kontaminierte Lebensmittel mit Listerien angesteckt zu haben, kann die Ärztin/ der Arzt eine Stuhlprobe an ein mikrobiologisches Labor für einen Listerienausschluss einsenden. Ein negatives Laborresultat sollte dann allfällige Sorgen beseitigen. Nur bei einem positiven Listerien-Nachweis im Stuhl kann man eine prophylaktische Gabe eines Antibiotikums in Erwägung ziehen; ohne kulturellen Erregernachweis gilt jedoch eine prophylaktische Antibiotikagabe als kontraindiziert, da das Risiko einer schweren Antibiotika-Nebenwirkung deutlich höher ist als das sehr niedrige Risiko, eine invasive Listeriose zu entwickeln.

Therapie

Bei invasiver Listeriose ist die Gabe von Antibiotika erforderlich. Dennoch verlaufen trotz gezielter Therapie bis zu 30 % der invasiven Listeriosen tödlich.

Vorbeugung

Allgemeine Grundregeln, um das Risiko von Lebensmittelinfektionen zu minimieren, sind:

  • Früchte, Beeren, Gemüse und vorgeschnittene verpackte Blattsalate vor Verzehr oder Weiterverarbeitung gründlich mit Leitungswasser abspülen
  • Fleisch- und Fischgerichte gründlich durchgaren
  • Rohmilch vor Verzehr abkochen
  • Faschiertes nicht roh essen
  • mögliche Risikolebensmittel wie Weichkäse, Schmierkäse, aufgeschnittene Wurstwaren oder geräucherte Fische immer getrennt von anderen Lebensmitteln lagern
  • immungeschwächte Menschen, Schwangere und Alte sollten auf den Verzehr möglicher Risikolebensmittel verzichten und keinesfalls nach Ablauf der Mindesthaltbarkeit verspeisen

Situation in Österreich

Mensch

2019 wurden 38 laborbestätigte Fälle an invasiver Listeriose gemeldet. Die 28-Tage-Letalität (= Gesamtletalität innerhalb von 28 Tagen nach Diagnosestellung) bei den invasiven Listeriosen betrug 15,7 % (6 von 38 Fällen).

Abbildung 1: Listeriose-Fälle in Österreich


Legende

    Abbildung 2: Inzidenz (Fälle/100.000 Einwohner*innen) nach Alter (über bzw. unter 65 Jahren)

    Lebensmittel

    Im Jahr 2019 wurden 3.480 Lebensmittelproben auf Listerien untersucht, davon 3.341 mittels qualitativer Methode (in 25 g), in 79 Proben wurden L. monocytogenes nachgewiesen:

    • in 47 von 820 untersuchten Fleischproben, davon in 27 von 570 verzehrfertigen Fleischproben (4,7 %), in 17 von 168 untersuchten fermentierten Würsten (10,1 %) sowie in drei von 59 Fleischprodukten ohne Angabe ob für den unmittelbaren Verzehr vorgesehen oder nicht (5,1%), jedoch in keiner von 23 Proben von Frischfleisch
    • in fünf von 223 untersuchten Proben von Fischen und Meeresfrüchten, davon in zwei von 24 Proben von rohem Fisch und Meeresfrüchten (8,3 %), in einer von 57 Proben von verzehrfertigem Fisch und Meeresfrüchten (1,8 %) und in zwei von 142 geräucherten Fischproben (1,4 %)
    • in drei von 242 untersuchten Käseproben hergestellt aus roher Milch: in zwei von 123 Proben von Weichkäse (1,6 %) und in einer von 56 untersuchten Proben von Frischkäse (1,8 %), jedoch nicht in Hartkäse aus roher Milch (n=63)
    • in 16 von 697 untersuchten anderen verzehrfertigen Speisen (2,3 %)
    • in drei von 83 anderen Speisen ohne genauere Angabe dazu (3,6 %)
    • in zwei von 246 untersuchten Proben von Backwaren und Getreide (0,8 %)
    • in drei von 122 Proben von Obst, Gemüse und Salaten

    Nicht nachgewiesen wurde L. monocytogenes in 263 Proben von Frisch-, Hart- und Weichkäse aus pasteurisierter Milch; in 117 Käseproben ohne Angabe zur Milch; in 416 Proben von Milch- und Milcherzeugnissen (ohne Käse, davon 30 Proben von Rohmilch), in 25 Eiprodukten, in 74 Proben Säuglingsnahrung, und 13 Proben Süßigkeiten.

    Sechs Proben enthielten mehr als 100 Kolonie-bildende Einheiten von L. monocytogenes je Gramm untersuchtes Lebensmittel (KBE/g), 18 Proben enthielten L. monocytogenes zwischen 10-100 KBE/g: acht Proben verzehrfertiges Fleisch, je drei Proben von Würsten und anderen Speisen, zwei Proben von Fleischprodukten sowie je eine Probe von rohen Fischen und Meeresfrüchten und verzehrfertigen Fischen und Meeresfrüchten.

    Keimreservoir Lebensmittel

    Sofern keine Oberflächenkontamination oder nachträgliche Kontamination nach Öffnung der Verpackung erfolgt, sind einige Lebensmittel weitgehendst frei von Listerien: Bei unbehandelten Lebensmitteln, z. B. bei Karotten, Tomaten und saurem Obst wie Äpfel und Birnen ist das Risiko äußerst gering, zumal wenn durch Waschen oder Schälen eine eventuelle Oberflächenkontamination entfernt wurde.

    Eine Kontamination von Lebensmitteln mit Listerien kann auf verschiedenen Stufen der Gewinnung und Bearbeitung erfolgen. Insbesondere Lebensmittel tierischer Herkunft wie Rohmilch und rohes Fleisch können bereits während der Gewinnung, z. B. beim Melken oder beim Schlachten, kontaminiert werden. Bei Käse, der aus unpasteurisierter Rohmilch hergestellt wird, ist eine Kontamination der Ausgangsmilch als Ursache für das Vorkommen von Listerien im Endprodukt nicht auszuschließen. Bei Käse, der aus wärmebehandelter Milch hergestellt wird, werden die Listerien bei der Pasteurisierung abgetötet. Bei mangelnder Hygiene im Bearbeitungsprozess ergeben sich jedoch nach der Wärmebehandlung erneute Kontaminationsmöglichkeiten für das Produkt. Meist erfolgt die für eine Infektionsübertragung relevante Kontamination von Käse erst bei der Reifung über eine Besiedelung der Rinde. In Käsesorten mit einer weichen, schmierigen Rinde können sich Listerien dann im Laufe der Reifung massiv vermehren. Sie sind oft nicht gleichmäßig über die gesamte Fläche, sondern vielmehr in Mikrokolonien punktuell verteilt.

    Die Überlebens- und Vermehrungsfähigkeit von Listerien in Lebensmitteln ist von der technologischen Behandlung bzw. dem Herstellungsverfahren abhängig. Kochen, Braten, Sterilisierien und Pasteurisieren tötet die Bakterien ab. In Lebensmitteln, die wenig Wasser, viel Salz oder Konservierungsstoffe enthalten, oder die sehr sauer sind (z. B. Sauerkraut, Mixed Pickles und Joghurt), ist eine Vermehrung nur noch verzögert oder überhaupt nicht mehr möglich. Gute Wachstumsmöglichkeiten im Vergleich zu konkurrierenden Keimen haben Listerien bei reduziertem Sauerstoffangebot (z .B. in Vakuumverpackungen von Brühwürsten, Lachs und Räucherfisch) und langen Lagerzeiten der Lebensmittel unter Kühlung.

    Tier

    In den meisten Fällen wird L. monocytogenes nicht über das Tier, sondern über die unbelebte Umwelt bei der Verarbeitung in das Lebensmittel eingebracht. Eine Überwachung des Tierbestandes auf Listerien gilt deshalb nicht als zweckmäßig. Bei Rohmilch gilt die Verunreinigung mit Kot als häufigste Eintragsquelle; vereinzelt wurde eine direkte Keimeinbringung über eine Mastitis belegt. In Niederösterreich wurde ein Ausbruch bekannt, bei dem 35 von insgesamt 450 Mastschweinen an Listeriose verstorben sind. Als Verursacher wurde die verfütterte, teilweise unzureichend fermentierte Maissilage identifiziert.

    Fachinformation

    Humanmedizin

    Diagnostik

    Der kulturelle Erregernachweis aus Blut, Liquor, Eiter, Punktaten oder (bei Neugeborenen) Abstrichen von Nabel, Ohr oder Mekonium ist anzustreben. Der Nachweis von Listerien erfolgt mittels standardisierten qualitativen, quantitativen sowie molekularbiologischen Methoden. Eine PCR aus Liquor kann eingesetzt werden, falls nach antibiotischer Vorbehandlung der kulturelle Erregernachweis nicht gelingt. Serologische Untersuchungen sind schlecht zu interpretieren, da Kreuzreaktionen bei Gesunden und fehlende Antikörpernachweise trotz Infektion häufig sind. Fast 90 % der erkrankten Menschen sind mit den drei Serovaren 4b, 1/2a und 1/2b assoziiert.

    Dr. Steliana Huhulescu, Univ.-Prof. Dr. Franz Allerberger: Produktrückrufe wegen Listerien: Konsequenzen für den hinzugezogenen Arzt?
    Erschienen in tägliche praxis 2018 Band 59 / 4

    Nationale Referenzzentrale für Listeriose

    Labordiagnostisches Leistungsspektrum

    Untersuchungsmaterial: Kulturisolat

    Routine:

    • Identifizierung mit biochemischen Methoden
    • Serovarbestimmung mittels Multiplex-PCR und mittels Agglutination
    • Typisierung mittels PFGE (Pulsfeld-Gelelektrophorese)
    • Antibiogramm mittels Agardiffusionstest

    Sonderuntersuchungen:

    • AFLP (Amplifikationsfragmentlängen-Polymorphismen)
    • Rep-PCR (Repetitive extragenic palindromic PCR)
    • Identifizierung mittels Sequenzierung
    • Bestimmung der Minimalen Hemmkonzentration mittels E-Test
    • Liquor: PCR auf Listeria monocytogenes
    • Stuhl: PCR auf  Listeria monocytogenes
    • Klinisches Untersuchungsmaterial: Direkte Anzucht auf festen und flüssigen Selektivnährböden

    Im Regelfall reichen die genannten Routineuntersuchungen für eine sichere Beantwortung aller klinisch-diagnostischen und epidemiologischen Fragestellungen aus. PCR aus Liquor kann eingesetzt werden, falls nach antibiotischer Vorbehandlung der kulturelle Erregernachweis nicht gelingt. Serologische Untersuchungen sind schlecht zu interpretieren, da Kreuzreaktionen bei Gesunden und fehlende Antikörpernachweise trotz Infektion insbesondere beim Widal-Test häufig sind. Wir empfehlen daher nur in Einzelfällen (z. B. Verdacht auf Rhombencephalitis) serologische Untersuchungen, falls der direkte Erregernachweis nicht geführt werden kann.

    Wenn VerbraucherInnen nach Warnungen über mit Listerien kontaminierte Lebensmittel Sorge haben, sich möglicherweise mit Listerien angesteckt zu haben, kann der Arzt eine Stuhlprobe an ein mikrobiologisches Labor für einen Listerienausschluss einsenden. Ein negatives Laborresultat sollte dann allfällige Sorgen beseitigen. Nur bei einem positiven Listerien-Nachweis im Stuhl kann  man eine prophylaktische Gabe von Amoxicillin in Erwägung ziehen; ohne kulturellen Erregernachweis gilt eine prophylaktische Antibiotikagabe als kontraindiziert, da das Risiko einer schweren Antibiotika-Nebenwirkung deutlich höher ist als das sehr niedrige Risiko, eine Listeriose zu entwickeln.

    Untersuchungen von Isolaten aus Lebensmittel- und Umweltproben erfolgen am Nationalen Referenzlabor für Listerien.

    Meldepflicht

    Gemäß § 1 Epidemiegesetz 1950 sind Listerien als Erreger der bakteriellen Lebensmittelvergiftung oder als Erreger invasiver bakterieller Erkrankungen (Sepsis, Meningoenzephalitis) meldepflichtig. Für die Meldung von schwangerschaftsassoziierten Listeriosefällen gilt zudem seit Juni 2013: Zu melden ist jede Fehl- oder Totgeburt aufgrund einer schwangerschaftsassoziierten Listerioseerkrankung der Mutter. Die Listerioseerkrankung der Mutter ist als gesonderter, meldepflichtiger Fall zu betrachten.

      Nationale Referenzzentrale für Listeriose - Jahresbericht 2018 (793 K)
      Datei Download  | PDF öffnen

      Listeriose Jahresbericht 2017 (3,63 M)
      Bericht der Nationalen Referenzzentrale für Listeriose
      Datei Download  | PDF öffnen

      Listerien Jahresbericht 2016 (1,09 M)
      Bericht der Nationalen Referenzzentrale für Listeriose
      Datei Download  | PDF öffnen

      Produktrückrufe wegen Listerien: Konsequenzen für den hinzugezogenen Arzt? (1,49 M)
      Erschienen in tägliche praxis 2018 Band 59 / 4
      Datei Download  | PDF öffnen

    Screening

    TaqMan Assay zum Screenen von Listeria monocytogenes Isolaten auf CT1248

    Bernhard Prewein, Patrick Hyden, Werner Ruppitsch
    Binationales Konsiliarlaboratorium für Listerien am Institut für Medizinische Mikrobiologie und Hygiene, AGES Wien, A-1090 Wien

    Kurzbeschreibung

    Real-time PCR Nachweis von L. monocytogenes CT1248 basierend auf lmo2231.

    Protokoll

    Proben: Alle getesteten Isolate sind genomsequenziert und stammen aus der Stammsammlung des binationalen Konsiliarlabors für Listerien. Fünf CT 1248 Isolate, elf willkürlich ausgewählte Isolate lmo2231 positiv, aber mit anderen Allelen, sowie 38 willkürlich ausgewählte Isolate lmo2231 negativ laut NGS.

    Alle Isolate wurden vierfach getestet.

    PCR Ansatz

    ReagenzMenge
    Reagenz
    2x Mastermix
    (LightCycler ® 480 Probes Master - Roche)
    Menge
    5 µL
    Reagenz
    Primer F
    Menge
    0,5 µL (of 10 µM)
    Reagenz
    Primer R
    Menge
    0,5 µL (of 10 µM)
    Reagenz
    Probe
    Menge
    0,2 µL (of 10 µM)
    Reagenz
    dH2O
    Menge
    1,8 µL
    Reagenz
    Template DNA
    Menge
    2 µL (1 ng/µL genomische DNA – Qubit Messung verdünnt in dH2O)
    Reagenz
    Total
    Menge
    10 µL

    Bedingungen

    95 °C 10 min

    45 Cycles of: 60 °C 1 min
    45 Cycles of: 95 °C 15 sec

    Gerät: LC480 Roche

    Primer F: GCGATGAATTTTAACGGATTTGAC
    Primer R: GCCGTCCACATTATCCTTTTTC
    Probe: 6FAM - TAATGACTGACAACATTGGCATGAACGG – BBQ

    Ergebnis

    Nur die Isolate vom Clustertyp 1248 zeigen ein positives Ergebnis (rote Kurven). Alle übrigen Isolate (lmo2231 negative und lmo2231 positive mit anderem Allel-Typ) waren negativ (grüne Kurven).

    Wir empfehlen mehr als 1ng/µL DNA für die Reaktion einzusetzen.

    Lebensmittelsicherheit

    Das Nationale Referenzlabor für Listerien ist zuständig für die Differenzierung bzw. Charakterisierung von Listerienisolaten aus Lebensmitteln und Umfeldproben.

    Die eingelangten Isolate werden mittels Ganzgenomsequenzierung typisiert (Van Walle et al. 2015). Zur Abklärung epidemiologischer Fragestellungen wie etwa der Bestätigung eines lebensmittelbedingten Listerioseausbruchs werden die Sequenzen mittels core genome MLST (cgMLST) Analyse ausgewertet (Rupptisch et al. 2015). Diese in-house Methode wurde 2015 gemeinsam mit der Uniklinik Münster und Ridom Bioinformatics entwickelt und findet seitdem internationale Verwendung (Van Walle et al. 2018). Das cgMLST Schema ist in der Software Ridom SeqSphere+ integriert. Zur Typisierung werden 1701 definierte Zielsequenzen analysiert und über einen Nomenklaturserver abgeglichen (https://www.cgmlst.org/ncs/schema/690488).

    Der Nachweis von Listerien aus Humanisolaten erfolgt durch die Nationale Referenzzentrale für Listeriose.

    Publikationen:

    Van Walle I, Torgny Björkman J, Cormican M, Dallman T, Mossong J, Moura M, Pietzka A,
    Ruppitsch W, Takkinen J, European Listeria WGS typing group. Retrospective validation of whole genome sequencing enhanced surveillance of listeriosis in Europe, 2010 to 2015. Euro
    Surveill. 2018;23(33):pii=1700798. https://doi.org/10.2807/1560-7917.ES.2018.23.33.1700798

    Van Walle I, Pietzka A, Moller Nielsen E, Takkinen J, Damjanova I, Michelacci V, Mossong J, Eelco F, Van Pelt W, Wolkowitz T, Borges, V, Jernberg C, Fisher I, Peters T, Agren J, Rizzi V, Da Silva Felicio MT, Struelns M, Palm D. European Centre for Disease Prevention and Control. Expert Opinion on the introduction of next-generation typing methods for food- and waterborne diseases in the EU and EEA. Stockholm: ECDC; 2015. Technical Report · October 2015. ISBN 978-92-9193-723-3; doi 10.2900/453641; catalogue number TQ-02-15-849-EN-N. 

    Ruppitsch W, Pietzka A, Prior K, Bletz B, Lasa Fernandez H, Allerberger F, Harmsen D, Mellmann A. Defining and evaluating a core genome MLST scheme for whole genome sequence-based typing of Listeria monocytogenes. J Clin Microbiol. 2015;53(9):2869-76. doi:10.1128/JCM.01193-15.

    Kontakt, Formulare

    Nationale Referenzzentrale für Listeriose
    Institut für Medizinische Mikrobiologie und Hygiene, AGES Wien
    Währingerstraße 25a
    A-1096 Wien
    Tel.: +43 50 555-37218
    E-mail: steliana.huhulescu@ages.at

    Nationales Referenzlabor für Listerien
    Beethovenstraße 6
    8010 Graz
    Mag. Dr. Ariane Pietzka
    Tel: +43 50 555-61269
    E-mail:ariane.pietzka@ages.at

    Downloads

    zur Übersicht
    x