Nationale Referenzzentrale für Listeriose - Binationales Konsiliarlabor für Listerien

Downloads
Zuletzt geändert: 18.11.2016

Der kulturelle Erregernachweis aus Blut, Liquor, Eiter, Punktaten oder (bei Neugeborenen) Abstrichen von Nabel, Ohr oder von Mekonium ist anzustreben. Fast 90 Prozent der Erkrankungen beim Menschen sind mit 3 der 13 Serovare der Listeria monocytogenes assoziiert (4b, 1/2a und 1/2b).  Der serologische Antikörpernachweis ist für eine Listeriose nur bei Serokonversion belegend.  Der Nachweis von Listerien erfolgt mittels standardisierten qualitativen, quantitativen sowie molekularbiologischen Methoden.

Der kulturelle Erregernachweis aus Blut, Liquor, Eiter, Punktaten oder (bei Neugeborenen) Abstrichen von Nabel, Ohr oder von Mekonium ist anzustreben. Fast 90 Prozent der Erkrankungen beim Menschen sind mit 3 der 13 Serovare der Listeria monocytogenes assoziiert (4b, 1/2a und 1/2b).  Der serologische Antikörpernachweis ist für eine Listeriose nur bei Serokonversion belegend.  Der Nachweis von Listerien erfolgt mittels standardisierten qualitativen, quantitativen sowie molekularbiologischen Methoden.

Diagnostik

Labordiagnostisches Leistungsspektrum

Untersuchungsmaterial: Kulturisolat

Routine:

Identifizierung mit biochemischen Methoden
Serovarbestimmung mittels Multiplex-PCR und mittels Agglutination
Typisierung mittels PFGE (Pulsfeld-Gelelektrophorese)
Antibiogramm mittels Agardiffusionstest

Sonderuntersuchungen:

AFLP (Amplifikationsfragmentlängen-Polymorphismen)
Rep-PCR (Repetitive extragenic palindromic PCR)
Identifizierung mittels Sequenzierung
Bestimmung der Minimalen Hemmkonzentration mittels E-Test
Liquor: PCR auf Listeria monocytogenes
Stuhl: PCR auf  Listeria monocytogenes
Serum: Listeriolysin O-IgG (LLO-IgG, Enzymimmunoassay)
Serum: Widal-Agglutinationreaktion (O:1, H:1, O:4b, H:4b)
Klinisches Untersuchungsmaterial: Direkte Anzucht auf festen und flüssigen Selektivnährböden

Im Regelfall reichen die genannten Routineuntersuchungen für eine sichere Beantwortung aller klinisch-diagnostischen und epidemiologischen Fragestellungen aus. PCR aus Liquor kann eingesetzt werden, falls nach antibiotischer Vorbehandlung der kulturelle Erregernachweis nicht gelingt. Serologische Untersuchungen sind schlecht zu interpretieren, da Kreuzreaktionen bei Gesunden und fehlende Antikörpernachweise trotz Infektion insbesondere beim Widal-Test häufig sind. Wir empfehlen daher nur in Einzelfällen (z. B. Verdacht auf Rhombencephalitis) serologische Untersuchungen, falls der direkte Erregernachweis nicht geführt werden kann.

Wenn VerbraucherInnen nach Warnungen über mit Listerien kontaminierte Lebensmittel Sorge haben, sich möglicherweise mit Listerien angesteckt zu haben, kann der Arzt eine Stuhlprobe an ein mikrobiologisches Labor für einen Listerienausschluss einsenden. Ein negatives Laborresultat sollte dann allfällige Sorgen beseitigen. Nur bei einem positiven Listerien-Nachweis im Stuhl kann  man eine prophylaktische Gabe von Amoxicillin in Erwägung ziehen; ohne kulturellen Erregernachweis gilt eine prophylaktische Antibiotikagabe als kontraindiziert, da das Risiko einer schweren Antibiotika-Nebenwirkung deutlich höher ist als das sehr niedrige Risiko, eine Listeriose zu entwickeln.

Untersuchungen von Isolaten aus Lebensmittel- und Umweltproben erfolgen am Nationalen Referenzlabor für Listerien.

Meldepflicht

Gemäß § 1 Epidemiegesetz 1950 sind Listerien als Erreger der bakteriellen Lebensmittelvergiftung oder als Erreger invasiver bakterieller Erkrankungen (Sepsis, Meningoenzephalitis) meldepflichtig. Für die Meldung von schwangerschaftsassoziierten Listeriosefällen gilt zudem seit Juni 2013: Zu melden ist jede Fehl- oder Totgeburt aufgrund einer schwangerschaftsassoziierten Listerioseerkrankung der Mutter. Die Listerioseerkrankung der Mutter ist als gesonderter, meldepflichtiger Fall zu betrachten.

Screening

TaqMan Assay zum Screenen von Listeria monocytogenes Isolaten auf CT1248

Bernhard Prewein, Patrick Hyden, Werner Ruppitsch
Binationales Konsiliarlaboratorium für Listerien am Institut für Medizinische Mikrobiologie und Hygiene, AGES Wien, A-1090 Wien

Kurzbeschreibung

Real-time PCR Nachweis von L. monocytogenes CT1248 basierend auf lmo2231.

Protokoll

Proben: Alle getesteten Isolate sind genomsequenziert und stammen aus der Stammsammlung des binationalen Konsiliarlabors für Listerien. Fünf CT 1248 Isolate, elf willkürlich ausgewählte Isolate lmo2231 positiv, aber mit anderen Allelen, sowie 38 willkürlich ausgewählte Isolate lmo2231 negativ laut NGS.

Alle Isolate wurden vierfach getestet.

PCR Ansatz

ReagenzMenge
2x Mastermix
(LightCycler ® 480 Probes Master - Roche)
5 µL
Primer F0,5 µL (of 10 µM)
Primer R0,5 µL (of 10 µM)
Probe0,2 µL (of 10 µM)
dH2O1,8 µL
Template DNA2 µL (1 ng/µL genomische DNA – Qubit Messung verdünnt in dH2O)
Total10 µL

Bedingungen

95 °C 10 min

45 Cycles of: 60 °C 1 min
45 Cycles of: 95 °C 15 sec

Gerät: LC480 Roche

Primer F: GCGATGAATTTTAACGGATTTGAC
Primer R: GCCGTCCACATTATCCTTTTTC
Probe: 6FAM - TAATGACTGACAACATTGGCATGAACGG – BBQ

Ergebnis

Nur die Isolate vom Clustertyp 1248 zeigen ein positives Ergebnis (rote Kurven). Alle übrigen Isolate (lmo2231 negative und lmo2231 positive mit anderem Allel-Typ) waren negativ (grüne Kurven).

Wir empfehlen mehr als 1ng/µL DNA für die Reaktion einzusetzen.

Kontakt

Mag. Dr. Werner Ruppitsch
Währingerstraße 25a
1096 Wien
Mag. Dr. Werner Ruppitsch
Währingerstraße 25a
1096 Wien

Versand Deutschland

Vor jedem Versand, aber mindestens bei dringlichen Proben (z. B. Ausbruchsverdacht), bitten wir um vorherige telefonische Ankündigung unter Tel. +43 (0) 50555-37218 (Fr. Dr. Huhulescu) oder -37111 (Zentrale). Gerne geben wir zum Versand persönlich Auskunft.

Anschrift:

Binationales Konsiliarlabor für Listerien
AGES (IMED Wien)
Währingerstr. 25a
A-1096 Wien
Österreich
Tel. +49 (0) 50555-37111

Für den Versand gelten die Vorgaben nach UN Nr. 3373, Biologische Substanz, Kategorie B.

Laut Auskunft der Deutschen Post wird der Transport nach Österreich durchgeführt von

DHL Express Germany GmbH
Gefahrgutmanagement
Dreizehnmorgenweg 44-48
D-53175 Bonn
e-mail: dangerousgoodsgermany@dhl.com
Tel. +49 (0) 1805 345 300 (14 ct/angefangene Minute aus dem deutschen Festnetz)

Die Konsiliardiagnostik wird unentgeltlich erbracht, aber die Versandkosten können dem Einsender nicht erstattet werden.

Hilfsweise werden Proben (Inlandversand mit der Deutschen Post: Maxibrief, Verpackung gemäß P650, versandt als UN 3373, Biologische Substanz, Kategorie B) auch entgegengenommen und an uns weitergeleitet vom:

Nationalen Referenzzentrums für Salmonellen und andere bakterielle Enteritiserreger am Robert Koch-Institut
Burgstr. 37
D-38855 Wernigerode
Tel. +49 (0) 30-18754-4206

Informationen des Robert Koch-Instituts zum Versand von infektiösen Probenmaterial

Kontakt

Dr. Steliana Huhulescu
Telefon: +43 50 555-37218
Währingerstraße 25a
1096 Wien



Dr. Steliana Huhulescu
Telefon: +43 50 555-37218
Währingerstraße 25a
1096 Wien




x