Listeria

Listeria are bacteria. They are the causative agent of listeriosis, a rare, mainly food-borne disease.

Occurrence

Listeria are widely spread in the environment, e.g. in waste water, in soil and on plants. Food of animal origin such as raw milk and raw milk products and raw meat, but also meat and fish products such as sliced, packaged sausage and smoked fish may contain Listeria. Products made from pasteurised milk, such as soft or cream cheese, can get contaminated during production.

Reservoir

L. monocytogenes are found in the environment, soil and water. Although animals can carry the pathogen without becoming ill, miscarriages caused by listeria occur in ruminants. Food processing plants can be a reservoir for these pathogens, therefore (further) processed food can get contaminated. Due to their ability to grow even at low temperatures, Listeria even multiply in the refrigerator; therefore, contaminated food may contain high bacterial counts after storage in the refrigerator.

Mode of transmission

The pathogen is mainly absorbed by the consumption of contaminated animal and plant products. In pregnant women, the pathogens can also be transmitted to the unborn child without any symptoms of maternal illness. Very rarely, further spread occurs through human-to-human transmission (hospital infections of newborns) and through direct contact with infected animals (skin infections).

Incubation period

In case of an infection via contaminated food, the first symptoms can appear within 1-70 days. Septicemic courses: 1-12 days (median 2 days); neurological courses: 1-14 days (median 9 days); pregnancy-associated cases: 17-70 days (median 27.5 days).

Symptoms

In healthy adults, an infection usually progresses without symptoms or only with diarrhoea. In general, the human immune system provides sufficient protection against severe disease progression and many infections pass unnoticed and without consequences. Serious cases mainly develop in immunocompromised people (e.g. people suffering from cancer, patients under high-dose cortisone therapy, etc.). If listeriosis is diagnosed, there is almost always an invasive course of the disease, which means that the bacteria spread beyond the digestive tract. Invasive listeriosis manifests itself by severe headaches, severe fever, nausea and vomiting. As a result, it can lead to meningitis or sepsis, which is fatal in about a quarter of patients. The pathogen can also cause inflammatory processes in other parts of the body (e.g. inflammation of the vertebral bodies), but these symptoms are rarely observed. In pregnant women, there is a risk of infection of the unborn child with the risk of premature or stillbirth. Sepsis and meningitis may develop in the infected newborn.

If consumers are concerned that they may have eaten food contaminated with listeria because of product recalls or warnings, the doctor can send a stool sample to a microbiological laboratory for listeria exclusion. A negative laboratory result should eliminate any concerns. Only if listeria are detected in the stool prophylactic administration of an antibiotic can be considered. However, without cultural pathogen detection, prophylactic antibiotic administration is considered contraindicated, as the risk of a severe antibiotic side effect is significantly higher than the very low risk of developing invasive listeriosis.

Treatment

In case of invasive listeriosis, administration of antibiotics is necessary. Nevertheless, up to 30% of invasive listeriosis cases are fatal despite targeted therapy.

Preventive measures

General basic rules to minimize the risk of foodborne infections are:

• Rinse fruits, berries, vegetables and pre-cut packed lettuce thoroughly with tap water before consumption or further processing
• Cook meat and fish dishes thoroughly
• Boil raw milk before consumption
• Do not eat raw minced meat
• Always store potentially hazardous foods such as soft cheese, sliced sausages or smoked fish separately from other food products
• Immunocompromised people, pregnant women and the elderly should refrain from eating potentially risky foods. Do not eat these products after the expiration date has passed

In 2018, 2,887 food samples were tested for Listeria using a qualitative method (in 25 g) and L. monocytogenes was detected in 72 samples:

• in 46 out of 672 meat samples tested (6 fresh meat samples, 3 meat products without indication whether intended for immediate consumption, 11 ready-to-eat meat samples, 26 fermented sausages)
• in 7 out of 259 fish and seafood samples tested (4 times raw fish, 3 times smoked fish)
• in 6 out of 517 cheese samples tested (1 fresh cheese from raw milk, 3 soft cheeses from raw milk, 2 soft cheeses without any indication of the milk used)
• in 1 of 44 ready-to-eat lettuce samples
• in 12 of 627 other ready-to-eat meals

L. monocytogenes has not been detected in milk and milk products (excluding cheese), bakery products, fruit and vegetables, prepared dishes such as pasta and egg products. Four samples contained more than 100 colony-forming units of L. monocytogenes per gram of food analysed (CFU/g), 21 samples contained L. monocytogenes between 10-100 CFU/g.

Bacterial reservoir food

Provided there is no surface contamination or subsequent contamination after opening the packaging, some foods are mostly free of listeria: In the case of untreated foods, e.g. carrots, tomatoes and sour fruits such as apples and pears, the risk is extremely low, especially if any possible surface contamination has been removed by washing or peeling.

Listeria contamination of food can occur at various stages of production and processing. In particular, food of animal origin, such as raw milk and raw meat, can be contaminated during production, for example during milking or slaughter. In the case of cheese produced from unpasteurised raw milk, contamination of the raw milk cannot be excluded as cause of presence of listeria in the final product. In the case of cheese made from heat-treated milk, listeria are killed during pasteurisation. However, if there is a lack of hygiene in the processing process, there is a risk of recontamination after heat treatment. In most cases, the contamination of cheese only occurs during maturation via colonisation of the rind. In cheese types with a soft, greasy rind, listeria can multiply massively during the maturation process. The bacteria are often not evenly distributed over the entire surface, but rather distributed in microcolonies at specific areas.

The survival and multiplication of listeria in food depends on the technological treatment or the manufacturing process. Cooking, frying, sterilizing and pasteurizing kills the bacteria. In foods that contain little water, a lot of salt or preservatives, or that are very acidic (e.g. sauerkraut, mixed pickles and yoghurt), reproduction is only possible at low rates or not at all. Compared to competing germs, listeria can grow at reduced oxygen supply (e.g. in vacuum packaging of cooked sausages, salmon and smoked fish) and long storage times of the food under refrigeration.

In most cases, the food is not contaminated with listeria through livestock but during food processing. Monitoring of livestock for listeria is therefore not considered appropriate. For raw milk, faecal contamination is considered the most common source of entry; in a few cases direct germ introduction via mastitis has been demonstrated. In Lower Austria an outbreak in which 35 of a total of 450 fattening pigs died of listeriosis was reported. The causative agent was identified as corn silage which was fed to the pigs and has been insufficiently fermented.

Diagnostics

The detection of listeria should be persued by bacterial cultures from blood, cerebrospinal fluid, pus, punctates or (in newborns) smears from navel, ear or meconium. Listeria are detected by standardized qualitative, quantitative and molecular biological methods. A PCR from cerebrospinal fluid can be used if a bacterial culture cannot be obtained after antibiotic pretreatment of the patient. Serological tests are difficult to interpret, as cross-reactions in healthy individuals and lack of antibody detection despite infection are common. Nearly 90% of infected people are associated with the three serovars 4b, 1/2a and 1/2b.

Dr. Steliana Huhulescu, University Professor Dr. Franz Allerberger: Product recalls due to listeria: Consequences for the consulting physician? Published in daily practice 2018 Volume 59 / 4

National Reference Centre for Listeriosis

Laboratory diagnostic service 

Test material: culture isolate

Routine:

• Identification using biochemical methods
• Serovar identification using multiplex PCR and agglutination
• Type identification using PFGE (pulse field gel electrophoresis)
• Antibiotic sensitivity testing by agar diffusion test

Special tests:

• AFLP (amplification fragment length polymorphisms)
• Rep-PCR (Repetitive extragenic palindromic PCR)
• Identification by sequencing
• Determination of the minimum inhibitory concentration by Etest
• Liquor: PCR for Listeria monocytogenes
• Stool: PCR for Listeria monocytogenes
• Clinical test material: Direct cultivation on solid and liquid selective media

The routine tests mentioned above usually suffice to answer all clinical-diagnostic and epidemiological questions reliably. PCR from liquor can be used if a bacterial culture cannot be obtained after antibiotic pre-treatment. Serological tests are difficult to interpret, as cross reactions in healthy individuals and lack of antibody detection despite infection are common, especially in the Widal test. We therefore recommend serological tests only in individual cases (e.g. suspected rhombencephalitis) if direct pathogen detection is not possible.

Should consumers be worried about having been infected with listeria after warnings about contaminated food products, their doctor can send a stool sample to a microbiology lab for a listeria test. A negative laboratory result should then eliminate any concerns. Only if  Listeria are found in the stool sample, a prophylactic administration of amoxicillin can be considered; without pathogen detection via bacterial culture, a prophylactic antibiotic administration is considered contraindicated, since the risk of a severe antibiotic side effect is significantly higher than the very low risk of developing listeriosis.

The National Reference Laboratory for Listeria tests food and environmental samples for listeria.

Reporting obligation

According to § 1 Epidemic Law 1950, listeria are notifiable pathogens of bacterial food poisoning or as pathogens of invasive bacterial diseases (sepsis, meningoencephalitis). In addition, since June 2013, the following has applied to reporting of pregnancy-associated listeriosis cases: every miscarriage or stillbirth due to a pregnancy-associated listeriosis case of the mother must be reported. The mother's listeriosis must be considered a separate case that must be reported.

TaqMan assay for screening Listeria monocytogenic isolates on CT1248

Bernhard Prewein, Patrick Hyden, Werner Ruppitsch
Binational Consiliary Laboratory for Listeria at the Institute for Medical Microbiology and Hygiene, AGES Vienna, A-1090 Vienna

Brief description

Real-time PCR detection of L. monocytogenes CT1248 based on lmo2231.

Protocol

Samples: All tested isolates are sequenced and derive from the strain collection of the Binational Consiliary Laboratory for Listeria. Five CT 1248 isolates, eleven randomly selected isolates lmo2231 positive but with other alleles, and 38 randomly selected isolates lmo2231 negative according to NGS.

All isolates were tested four times.

PCR protocol

PCR Conditions

95 °C 10 min

45 Cycles of: 60 °C 1 min
45 Cycles of: 95 °C 15 sec

Device: LC480 Roche

Primer F: GCGATGAATTTTAACGGATTTGAC
PrimerR: GCCGTCCACATTATCCTTTTTC
Probe: 6FAM - TAATGACTGACAACATTGGCATGAACGG - BBQ

Result

Only the isolates of cluster type 1248 show a positive result (red curves). All other isolates (lmo2231 negative and lmo2231 positive with different allele type) were negative (green curves).

We recommend to use more than 1 ng/µL DNA for the reaction.

National Reference Centre for Listeriosis
Institute for Medical Microbiology and Hygiene, AGES Vienna

Währingerstraße 25a
1096 Vienna

Dr. Steliana Huhulescu
Tel: +43 50 555-37218
E-mail: steliana.huhulescu@ages.at

National Reference Laboratory for Listeria

Beethovenstraße 6
8010 Graz