Listeria

Listeria are bacteria. They are the causative agent of listeriosis, a rare, mainly food-borne disease.

Occurrence

Listeria are widely spread in the environment, e.g. in waste water, in soil and on plants. Food of animal origin such as raw milk and raw milk products and raw meat, but also meat and fish products such as sliced, packaged sausage and smoked fish may contain Listeria. Products made from pasteurised milk, such as soft or cream cheese, can get contaminated during production.

Reservoir

L. monocytogenes are found in the environment, soil and water. Although animals can carry the pathogen without becoming ill, miscarriages caused by listeria occur in ruminants. Food processing plants can be a reservoir for these pathogens, therefore (further) processed food can get contaminated. Due to their ability to grow even at low temperatures, Listeria even multiply in the refrigerator; therefore, contaminated food may contain high bacterial counts after storage in the refrigerator.

Mode of transmission

The pathogen is mainly absorbed by the consumption of contaminated animal and plant products. In pregnant women, the pathogens can also be transmitted to the unborn child without any symptoms of maternal illness. Very rarely, further spread occurs through human-to-human transmission (hospital infections of newborns) and through direct contact with infected animals (skin infections).

Incubation period

In case of an infection via contaminated food, the first symptoms can appear within 1-70 days. Septicemic courses: 1-12 days (median 2 days); neurological courses: 1-14 days (median 9 days); pregnancy-associated cases: 17-70 days (median 27.5 days).

Symptoms

In healthy adults, an infection usually progresses without symptoms or only with diarrhoea. In general, the human immune system provides sufficient protection against severe disease progression and many infections pass unnoticed and without consequences. Serious cases mainly develop in immunocompromised people (e.g. people suffering from cancer, patients under high-dose cortisone therapy, etc.). If listeriosis is diagnosed, there is almost always an invasive course of the disease, which means that the bacteria spread beyond the digestive tract. Invasive listeriosis manifests itself by severe headaches, severe fever, nausea and vomiting. As a result, it can lead to meningitis or sepsis, which is fatal in about a quarter of patients. The pathogen can also cause inflammatory processes in other parts of the body (e.g. inflammation of the vertebral bodies), but these symptoms are rarely observed. In pregnant women, there is a risk of infection of the unborn child with the risk of premature or stillbirth. Sepsis and meningitis may develop in the infected newborn.

If consumers are concerned that they may have eaten food contaminated with listeria because of product recalls or warnings, the doctor can send a stool sample to a microbiological laboratory for listeria exclusion. A negative laboratory result should eliminate any concerns. Only if listeria are detected in the stool prophylactic administration of an antibiotic can be considered. However, without cultural pathogen detection, prophylactic antibiotic administration is considered contraindicated, as the risk of a severe antibiotic side effect is significantly higher than the very low risk of developing invasive listeriosis.

Treatment

In case of invasive listeriosis, administration of antibiotics is necessary. Nevertheless, up to 30% of invasive listeriosis cases are fatal despite targeted therapy.

Preventive measures

General basic rules to minimize the risk of foodborne infections are:

• Rinse fruits, berries, vegetables and pre-cut packed lettuce thoroughly with tap water before consumption or further processing
• Cook meat and fish dishes thoroughly
• Boil raw milk before consumption
• Do not eat raw minced meat
• Always store potentially hazardous foods such as soft cheese, sliced sausages or smoked fish separately from other food products
• Immunocompromised people, pregnant women and the elderly should refrain from eating potentially risky foods. Do not eat these products after the expiration date has passed

In 2020, 41 laboratory-confirmed cases of invasive listeriosis were reported. The 28-day lethality (= total lethality within 28 days of diagnosis) for invasive listeriosis was 30% (12 of 41 cases). No test material was sent to the national reference centre for listeriosis from one patient, therefore only 40 cases appear in the 2020 annual report.

In 2020, 3,335 food samples were tested for Listeria, of which 3,170 were tested by qualitative method (in 25 g); L . monocytogenes were detected in 58 samples:

• in two out of 97 (2.1 %) samples of raw ready-to-eat pork products tested and in three out of 32 (9.4 %) unspecified ready-to-eat pork products tested
• in two out of 12 (16,7 %) samples of mixed, not ready-to-eat meat products
• in three out of 140 (2,1 %) samples of cooked, ready-to-eat meat products and in 12 out of 119 (10,0 %) fermented sausages tested
• in two out of 36 (5,6 %) samples of ready-to-eat fish products and in four out of 79 (5,1 %) smoked fish products
• in one out of 49 analysed samples of sliced fruits
• in 13 out of 608 (2.1 %) other ready-to-eat foods tested.

One sample (ready-to-eat pork product) contained more than 100 colony-forming units of L. monocytogenes per gram of food tested (CFU/g), four samples contained L. monocytogenes between 10-100 CFU/g: one sample of ready-to-eat pork, one sample of cooked meat products, one sample of the sausages tested, and one sample of Gravad salmon.

L. monocytogenes was not detected in 612 samples of fresh, hard and soft cheeses made from pasteurised milk and raw milk, in 115 samples of pastry products, in 22 egg products, in 20 samples of spices, in 41 samples of smoked fish and in 70 samples of ready-to-eat salads.

Germ reservoir food

Provided there is no surface contamination or subsequent contamination after opening the packaging, some foods are largely free of Listeria: In untreated foods, e.g. carrots, tomatoes and acidic fruits such as apples and pears, the risk is extremely low, especially if any surface contamination has been removed by washing or peeling.

Contamination of food with Listeria can occur at various stages of production and processing. In particular, food of animal origin such as raw milk and raw meat can be contaminated during production, e.g. during milking or slaughter. In the case of cheese made from unpasteurised raw milk, contamination of the raw milk cannot be excluded as a cause for the presence of Listeria in the final product. In the case of cheese made from heat-treated milk, the Listeria are killed during pasteurisation. However, if hygiene is poor in the processing procedure, there is a possibility of renewed contamination of the product after heat treatment. In most cases, the contamination of cheese relevant for infection transmission only occurs during ripening via colonisation of the rind. In cheeses with a soft, greasy rind, Listeria can then multiply massively in the course of ripening. They are often not distributed evenly over the entire surface, but rather in micro-colonies at specific points.

The ability of Listeria to survive and multiply in food depends on the technological treatment or the production process. Cooking, frying, sterilizing and pasteurizing kills the bacteria. In foods that contain little water, a lot of salt or preservatives, or that are very acidic (e.g. sauerkraut, mixed pickles and yoghurt), reproduction is only possible with a delay or not at all. Listeria have good growth opportunities compared to competing germs in the case of reduced oxygen supply (e.g. in vacuum packaging of cooked sausages, salmon and smoked fish) and long storage times of the food under refrigeration.

In most cases, L. monocytogenes is not introduced into food via the animal but via the inanimate environment during processing. Monitoring of livestock for Listeria is therefore not considered appropriate. In the case of raw milk, contamination with faeces is considered to be the most frequent source of introduction; in isolated cases, direct introduction of the bacteria via mastitis has been documented.

Diagnostics

The detection of listeria should be persued by bacterial cultures from blood, cerebrospinal fluid, pus, punctates or (in newborns) smears from navel, ear or meconium. Listeria are detected by standardized qualitative, quantitative and molecular biological methods. A PCR from cerebrospinal fluid can be used if a bacterial culture cannot be obtained after antibiotic pretreatment of the patient. Serological tests are difficult to interpret, as cross-reactions in healthy individuals and lack of antibody detection despite infection are common. Nearly 90% of infected people are associated with the three serovars 4b, 1/2a and 1/2b.

Dr. Steliana Huhulescu, University Professor Dr. Franz Allerberger: Product recalls due to listeria: Consequences for the consulting physician? Published in daily practice 2018 Volume 59 / 4

National Reference Centre for Listeriosis

Laboratory diagnostic service 

Test material: culture isolate

Routine:

• Identification using biochemical methods
• Serovar identification using multiplex PCR and agglutination
• Type identification using PFGE (pulse field gel electrophoresis)
• Antibiotic sensitivity testing by agar diffusion test

Special tests:

• AFLP (amplification fragment length polymorphisms)
• Rep-PCR (Repetitive extragenic palindromic PCR)
• Identification by sequencing
• Determination of the minimum inhibitory concentration by Etest
• Liquor: PCR for Listeria monocytogenes
• Stool: PCR for Listeria monocytogenes
• Clinical test material: Direct cultivation on solid and liquid selective media

The routine tests mentioned above usually suffice to answer all clinical-diagnostic and epidemiological questions reliably. PCR from liquor can be used if a bacterial culture cannot be obtained after antibiotic pre-treatment. Serological tests are difficult to interpret, as cross reactions in healthy individuals and lack of antibody detection despite infection are common, especially in the Widal test. We therefore recommend serological tests only in individual cases (e.g. suspected rhombencephalitis) if direct pathogen detection is not possible.

Should consumers be worried about having been infected with listeria after warnings about contaminated food products, their doctor can send a stool sample to a microbiology lab for a listeria test. A negative laboratory result should then eliminate any concerns. Only if  Listeria are found in the stool sample, a prophylactic administration of amoxicillin can be considered; without pathogen detection via bacterial culture, a prophylactic antibiotic administration is considered contraindicated, since the risk of a severe antibiotic side effect is significantly higher than the very low risk of developing listeriosis.

The National Reference Laboratory for Listeria tests food and environmental samples for listeria.

Reporting obligation

According to § 1 Epidemic Law 1950, listeria are notifiable pathogens of bacterial food poisoning or as pathogens of invasive bacterial diseases (sepsis, meningoencephalitis). In addition, since June 2013, the following has applied to reporting of pregnancy-associated listeriosis cases: every miscarriage or stillbirth due to a pregnancy-associated listeriosis case of the mother must be reported. The mother's listeriosis must be considered a separate case that must be reported.

TaqMan assay for screening Listeria monocytogenic isolates on CT1248

Bernhard Prewein, Patrick Hyden, Werner Ruppitsch
Binational Consiliary Laboratory for Listeria at the Institute for Medical Microbiology and Hygiene, AGES Vienna, A-1090 Vienna

Brief description

Real-time PCR detection of L. monocytogenes CT1248 based on lmo2231.

Protocol

Samples: All tested isolates are sequenced and derive from the strain collection of the Binational Consiliary Laboratory for Listeria. Five CT 1248 isolates, eleven randomly selected isolates lmo2231 positive but with other alleles, and 38 randomly selected isolates lmo2231 negative according to NGS.

All isolates were tested four times.

PCR protocol

PCR Conditions

95 °C 10 min

45 Cycles of: 60 °C 1 min
45 Cycles of: 95 °C 15 sec

Device: LC480 Roche

Primer F: GCGATGAATTTTAACGGATTTGAC
PrimerR: GCCGTCCACATTATCCTTTTTC
Probe: 6FAM - TAATGACTGACAACATTGGCATGAACGG - BBQ

Result

Only the isolates of cluster type 1248 show a positive result (red curves). All other isolates (lmo2231 negative and lmo2231 positive with different allele type) were negative (green curves).

We recommend to use more than 1 ng/µL DNA for the reaction.

National Reference Laboratory for Listeriosis - Institute of Medical Microbiology and Hygiene, AGES Vienna
Währingerstraße 25a A-1096 Vienna
Tel.: +43 50 555-37218
E-mail: sonja.pleiningerno@Spam@agesno.Spam.at

National Reference Laboratory for Listeria
Beethovenstraße 6 8010 Graz
Mag. Dr. Ariane Pietzka
Tel: +43 50555-61269
E-mail: ariane.pietzkano@Spam@agesno.Spam.at