National Reference Centre for Listeriosis – Binational Consiliary Laboratory for Listeria

Downloads
Changed on: 08.11.2017

The identification of pathogen cultures from blood, liquor, puss, punctate or (in neonates) swabs taken from the navel, ear or meconium. Almost 90 percent of the infections in humans are associated with three of the 13 serovars of Listeria monocytogenes (4b, 1/2a and 1/2b). The serological identification of antibodies only counts as evidence of listeriosis after seroconversion has occurred. Listeria are determined using standardised, qualitative, quantitative, and molecular biology methods.

The identification of pathogen cultures from blood, liquor, puss, punctate or (in neonates) swabs taken from the navel, ear or meconium. Almost 90 percent of the infections in humans are associated with three of the 13 serovars of Listeria monocytogenes (4b, 1/2a and 1/2b). The serological identification of antibodies only counts as evidence of listeriosis after seroconversion has occurred. Listeria are determined using standardised, qualitative, quantitative, and molecular biology methods.

Diagnostic

Laboratory diagnostic service range

Test material: culture isolate

Routine

Identification using biochemical methods
Serovar identification using multiplex PCR and agglutination
Type identification using PFGE (Pulsed-field gel electrophoresis)
Antibiogram using agar diffusion test

Special tests

AFLP (amplification fragment-length polymorphism)
Rep PCR (Repetitive extragenic palindromic PCR)
Identification using sequencing
Liquor: PCR for Listeria monocytogenes
Stool: PCR for Listeria monocytogenes
Serum: Listeriolysin O-IgG (LLO-IgG, enzyme immunoassay)
Serum: Widal agglutination reaction (O:1, H:1, O:4b, H:4b)
Clinical test material: direct cultivation on selective, solid and liquid nutrient media

The routine tests listed usually suffice to answer all clinically-diagnostic and epidemiological questions reliably. PCR from liquor can be used if the pathogen culture cannot be identified following previous antibiotic treatment. Serological tests are difficult to interpret as cross reactions in healthy specimen and a shortage of antibody evidence in Widal tests are very common. As a result, we only recommend serological tests in individual cases (e.g. suspicion of rhombencephalitis), if a direct pathogen test cannot be carried out. 

Should consumers be worried about having been infected with listeria after warnings about contaminated food products, their doctor can send a stool sample to a microbiology lab for a listeria test. A negative result should clear up all worries. The prophylactic administering of Amoxicillin may be considered only should the sample tested be positive for listeria; the prophylactic administering of antibiotics without testing the pathogen culture is considered contraindicative because the risk of severe side effects caused by the antibiotics is much higher than the very low risk of developing listeriosis.

Test of isolates from samples taken from food and the environment are carried out at the National Reference Laboratory for Listeria.

Reporting Obligation

Listeria are considered bacterial food poisoning pathogens and cause invasive, bacterial infections (sepsis, meningoencephalitis) and must be reported to the authorities in line with Art. 1 Austrian Epidemic Act 1950. The following has applied to reporting listeriosis cases associated with pregnancies since June 2013: any miscarriage and stillbirth caused by a pregnancy-associated listeriosis infection of the mother must be officially reported. The listeriosis infection of the mother must be considered a separate case that must be reported to the authorities.

Screening

TaqMan Assay for screening Listeria monocytogenes isolates for CT1248

Bernhard Prewein, Patrick Hyden, Werner Ruppitsch
Binational Consiliary Laboratory for Listeria at the Institute for Medical Microbiology and Hygiene, AGES Vienna, A-1090 Vienna

Abstract

Real-time PCR test for L. moncytogenes CT1248 based on Imo2231.

Protocol

Samples: all isolates tested are subject to genome sequencing and originate from the strain bank of the binational Consiliary Laboratory for Listeria. Five CT 1248 isolates, 11 randomly selected Imp2231positive isolates, but with different alleles, and 38 randomly selected Imo2231 negative isolates, according to NGS.

All isolates were tested four times.

PCR approach

Reagent   Quantity
2x Mastermix
(LightCycler ® 480 Probes Master - Roche)
5 µL
Primer F0,5 µL (of 10 µM)
Primer R0,5 µL (of 10 µM)
Sample0,2 µL (of 10 µM)
dH2O1,8 µL
Template DNA2 µL (1 ng/µL genomic DNA – Qubit measurement diluted in dH2O)
Total10 µL

Conditions

95 °C 10 min

45 Cycles of: 60 °C 1 min
45 Cycles of: 95 °C 15 sec

Device: LC480 Roche

Primer F: GCGATGAATTTTAACGGATTTGAC
Primer R: GCCGTCCACATTATCCTTTTTC
Sample: 6FAM - TAATGACTGACAACATTGGCATGAACGG – BBQ

Result

Only the isolates of cluster type 1248 showed positive results (red curves). All remaining isolates (lmo2231 negative and lmo2231 positive with different allele type) were negative (green curves).

We recommend using more than 1 ng/ µL DNA for the reaction.

Contact

Mag. Dr. Werner Ruppitsch
Währingerstraße 25a
1096 Wien
Mag. Dr. Werner Ruppitsch
Währingerstraße 25a
1096 Wien

Dispatch Germany

Please call +43 (0) 50555-37218 (Mrs. Dr. Huhulescu) or -37111 (HQ) before sending any samples, especially when sending urgent samples (e.g. outbreak suspected). We will gladly inform you about the delivery process.

Address:

Binational Consiliary Laboratory for Listeria
AGES (IMED Vienna)
Währingerstr. 25a
A-1096 Vienna
Austria
Tel. +49 (0) 50555-37111

The specifications listed in UN No. 3373, biological substance, category B apply for sending.

According to Deutsch Post, shipment to Austria is carried out by:

DHL Express Germany GmbH
Gefahrgutmanagement
Dreizehnmorgenweg 44-48
D-53175 Bonn
e-mail: dangerousgoodsgermany@dhl.com
Tel. +49 (0) 1805 345 300 (14 eurocent/per minute or part thereof when calling from a landline within Germany)

Consiliary diagnostics will be carried out free of charge; however, shipping costs will not be refunded.

Alternatively, samples (domestic shipment by Deutsche Post: Maxibrief, packaging in line with P650, sent as UN 3373, biological substance, category B) are also accepted and forwarded to us by the:

National Reference Centre for Salmonella and other Bacterial Enteritis Pathogens at the Robert Koch Institute
Burgstr. 37
D-38855 Wernigerode
Tel. +49 (0) 30-18754-4206

Information on sending infectious sample materials, provided by the Robert Koch Institute

Contact

Dr. Steliana Huhulescu
Phone: +43 50 555-37218
Währingerstraße 25a
1096 Wien



Dr. Steliana Huhulescu
Phone: +43 50 555-37218
Währingerstraße 25a
1096 Wien




x